Archivos de diario de junio 2022

09 de junio de 2022

Sinanodonta cf. woodiana 2 is a Sinanodonta woodiana?

Sinanodonta cf. woodiana 2 is a Sinanodonta woodiana?

Lopes-Lima, M. In the el al (2019) paper, Sinanodonta woodiana was divided into two groups, including Russia and the northern group (Sinanodonta cf. woodiana 2), and the southern group including Southeast Asia (Sinanodonta cf. woodiana 1).

I found a herd with the same COI gene (Sinandonta cf. woodiana 2) in Seosan and Boseong, Korea. That's why inaturalist records it that way. On the other hand, (Sinandonta cf. woodiana 1) is recorded in inaturalsit as Sinanodonta woodiana.

However, in 2021, Lopes et al recorded the same COI gene that I observed in Seosan as Sinanodonta woodiana in the NCBI.

https://www.ncbi.nlm.nih.gov/nuccore/MZ512215
Lopes-Lima,M., Gurlek,M.E., Kebapci,U., Sereflisan,H., Yanik,T., Mirzajani,A., Neubert,E., Prie,V., Teixeira,A., Gomes-Dos-Santos,A., Barros-Garcia,D., Bolotov,I.N., Kondakov,A.V., Vikhrev,I.V., Tomilova,A.A., Ozcan,T., Altun,A., Goncalves,D.V., Bogan,A.E. and Froufe,E.

Then, can it be regarded as Sinanodonta woodiana (Sinanodonta cf. woodiana 2) that lives in temperate regions including Russia and Korea?

So, what species should be recorded (Sinanodonta cf. woodiana 1) in the tropics of Southeast Asia and southern China?

The phylogenetic tree is posted on the Hangul page that I run.

https://cafe.naver.com/yangpakor/43562

Publicado el 09 de junio de 2022 por pintail pintail | 0 comentarios | Deja un comentario

Sinanodonta woodiana

Sinanodonta woodiana has been documented for several traits, but it seems that it has recently been confirmed as a single species.
In a paper on an individual recently discovered in Iraq and a paper published in China in 2022, Sinanodonta woodiana is expressed as a group with the same COI gene.

Below is a partial sequence of the COI gene of Sinanodonta woodiana that I analyzed in 2020.

2020_02_25_39_LCO22me2.ab1 1318
CCCGATATAAATTGGAATCAATCTAGCATTATGGTCAGGTTTGGTTGGGTTAGCTTTAAGTCTTTTA
ATTCGAGCAGAGTTGGGTCAGCCAGGAAGGCTTTTAGGGGATGATCAGTTGTATAATGTTATTGTT
ACGGCTCATGCTTTTATAATAATTTTCTTCTTAGTTATACCTATAATGATTGGAGGGTTTGGGAATTG
ATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCTTTTCCTCGATTGAATAATTTAAGGTTTTGGT
TACTTGTGCCAGCGCTATTTTTATTATTAAGGTCTTCTTTGGTGGAAAGGGGCGTTGGTACAGGGTG
AACAGTATACCCACCTTTGTCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATTTAGCTATTTTTT
CTTTGCACCTTGCCGGTGCTTCATCTATTTTAGGCGCTGTTAATTTTATTTCTACTGTGGGGAATATA
CGGTCTCCTGGTTTGGTTGCTGAGCGAATTCCTTTGTTTGTATGAGCTGTTACCGTAACAGCTATTT
TATTAGTTGCTGCTTTGCCTGTTTTAGCACGGGCTATTACAATGCTTCTTACCGATCTTAATTTAAAT
ACTTCATTCTTTGACCCAACTGGGGGAGGAGACCCTATTTTGTATATGCCTCTATTTTGATTTTTTG
GTCACCCTGAAGGTAGAACAATCGTACAAGAGGTGAGGTCGAGTGGACTATGCGGATATGCACCA
AAAGCGTATCCGGCATGATAGCGATAGGGGAGGATCAAGACGTAATCCAAGAACATCTCCCGCCG
GATGAGTGAAAGAGCTGAACGAGGTCACACGGCGTGCGTAACGCGTAGTAGAGAAGCAGACATA
GGAAGCGCCGGAGACGCAGAGTTTTGGGCCCGGACTTCCGTGTGGTCTGGAGGGCCAGATAAAG
TGACAATCAAAGGACGACCAAGCTGAGACGGACTGTTTGTACGGAGCGAGGCCTGACGTTCAAA
GCGAATATAGGATTCGACCAGCAGACAGCTCTGGTAGATTTAGGTACATCGGAGTCGGCCGCACAT
AACGGGCTCGGTGGTGTGGTGCGCGAGTGAAGGGACGCAGGCGGGGTTAGAGGGTACCGAAGGC
GAGAAGGGAAATTCACGAGGGGTTGAGGTGAGTCGCGTGCGAGACGCGTTTAGGGGCAGAGTCG
TCGGCAACCGGCGATAGTAAATTGGGGGAAAGGACAAATGTCGACGGGGGACTTCCGAACGGTG
TGCCGGCATCGGACCGGAATTTAGAGAGTGTTGGGAGAAGCAGTGGGGAGAGGCACGTGGCGC

Publicado el 09 de junio de 2022 por pintail pintail | 0 comentarios | Deja un comentario

10 de junio de 2022

The specimen collected on January 1, 2020 in South Korea is concluded to be Sinandonta woodiana.

Freshwater mussels (Bivalvia: Unionidae) from the rising sun (Far East Asia): Based on phylogeny, systematics, and distribution (2020, Manuel Lopes-Lima et al.), I will tell the story below.

(Sinanodonta cf. woodiana 1) mentioned in the above paper is a very close relative of Sinanodonta lauta. and (Sinanodonta cf. woodiana 2) was recently recorded as Sinanodonta woodiana by Lopes et al.

The specimen collected on January 1, 2020 in South Korea is concluded to be Sinandonta woodiana.

Publicado el 10 de junio de 2022 por pintail pintail | 1 observación | 0 comentarios | Deja un comentario

11 de junio de 2022

Sinanodonta luata from South Korea has so many different shapes.

Sinanodonta luata from South Korea has so many different shapes.

Sinanodonta lauta has so many different lateral shapes and thicknesses that it is difficult to see it as a single species.

As other freshwater clams in South Korea show various shapes, it is very difficult to distinguish the species.

For this reason, it seems that many scholars in the past have recorded various species of freshwater clams of the genus Sinanodonta, including Sinanodonta lauta.

From December 2019 until now, with the help of Jae-Hoon Kim and Su-Min Seong, freshwater clams from all over South Korea were collected and the COI gene of mtDNA was analyzed. As a result, we collected photos of individuals identified as Sinanodonta lauta.

It's amazing to see so many different shapes.

Publicado el 11 de junio de 2022 por pintail pintail | 1 observación | 0 comentarios | Deja un comentario
Vida Silvestre es una entidad asociada a la Organización Mundial de Conservación